Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14869B6
Clone ID IST14869B6
Vector VICTR76
Project tigm

Sequence tag IST14869B6HMF1
Sequence
AAAGTACCCAGCTCCTGCCTTAGCATTAGGACCACGCAACTAAGTCACTTCCCGAGTCTGGCCCTCTAATATCTTAGTAG
CTAAAATTCCAAAGCCTTGTTTTCCATGACCTCCCAAGGGACCTCCCAACCTCTACAATAAAGGGCTGTTTCACAGGGCG
ATTTAATCCCANCACTTGGGAGACAGAGGCAGGCGGATTTCTGAGTTCGAGGCCNGCCTGGTCTACAGAGACTCCCANAA
GTAAAANAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 124894469..124894720 244
NO GENE  


Sequence tag IST14869B6HMR1
Sequence
CTTTCTGATGTCCTTCGCGTCTATGACTTTGCACAAATACAAGTCTTTGGCCGCATGCCCTAACAGCNACCGCACAACTG
CACAAGGCAGTAAGCAGTCACCANAGTGCCTGGAATCCTGCCTACCTAGGCATTTTTCTTAAAGGTGAAGGCCACAGGAG
CACAAGGTGGGTGACCTGCTTGCAAAACCCTTGTGCCCCACTGTANCTCCTCCCAACCTCAATGTCTTCATCANAATTCA
GGAGTAGCAGGTAGGAGTGCAGTCNCTCTGATCCNTTGGCTTGGGCTGGAACCNNNGTGTN
Sequence Type genomic DNA
Unitrap ID UNI5356

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 124894717..124895016 282
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049327 (Setd8) NM_030241 SET domain containing (lysine methyltransferase) 8 Gene [Source:MGI (curated);Acc:Setd8-001]


Sequence tag IST14869B6BBF1
Sequence
AAAGTACCCAGCTCCTGCCTTAGCATTAGGACCACGCAACTAAGTCACTTCCCGAGTCTGGCCCTCTAATATCTTAGTAG
CTAAAATTCCAAAGCCTTGTTTTCCATGACCTCCCAAGGGACCTCCCAACCTCTACAATAAAGGGCTGTTTCACAGGGCG
ATTTAATCCCAGCACTTGGGAGACAGAGGCAGGCGGATTTCTGAGTTCGAGGCCNGCCTGGTCTACAGAGACTCCCAGAA
GTAAAAAAAAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 124894455..124894720 264
NO GENE  

 
Come back to gene ENSMUSG00000049327


For any suggestions or comments, please send an email to unitrap@crg.es