Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10368E7
Clone ID IST10368E7
Vector VICTR76
Project tigm

Sequence tag IST10368E7BBF1
Sequence
CTTGCANAATCCAATTGAATTCCAAGAAAATGGGCTATAGTGAGCACAAGTCACCCCTCTCTGGAGCTTCCTGCTAGGGA
GAATAGGTCTTTATATTGAATGAACAGGAGGCAGGAGCTGGAGCCCACAGGAGGTGATGGAAGGAAATGGTTTTGCTTTG
TTGGTCTCCCCACTCCCATCCCTCACCCTTTGGTAGGGTAGGGTGGTGAAACTAGGCCCTGCTAGGCTGGCCTGAAACTC
ATCCTTTTTGGTTTTTTGAGACACAGTTTCTCTGTATAGCCCTGCTGACTGTCCTGGAACTCACTCTGTANNCCAGGCTA
NCTTCNAACTCANAAATCCACCNNCCTCTGCCTCCCAAGTACTGGGATTAAAGGCGTGTGCCACCACTGTCCAGCCTGAA
ACTCATTCTGTAACCCANATTGGCCTAAATTTTGAGACAATTCTTTTGCCTCANCCTCTTGAGTACTACTGCGATTACAG
ATGGAAGCCTTCTTTTCAAAATAGAAGANTGACAGCGTGATCTNNNNNATCATGCCTATAATACCNNATTTANTGGNTAN
GGANCNNNANGATN
Sequence Type genomic DNA
Unitrap ID UNI13516

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 104617441..104618003 521
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002227 (Mov10) NM_008619 Moloney leukemia virus 10 Gene [Source:MGI (curated);Acc:Mov10-002]

 
Come back to gene ENSMUSG00000002227


For any suggestions or comments, please send an email to unitrap@crg.es