Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CE0173
Clone ID CE0173
Vector pGT0lxfT2v
Project sanger

Sequence tag CE0173
Sequence
CCCCCCCAAATATGCATATGTGAAAAGGCCGAAAAGTGAGGCCGCTGGCAGGGAGTCTTAACTAGAGAAAGAAACGGGAC
CAAACTGGCGGGCCCAGTGAGAGCGAAGCGGGCAGCTCTCCGGAATAG
Sequence Type mRNA
Unitrap ID UNI1933

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95021511..95021638 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038766 (Gabpb2) NM_172512 GA repeat binding protein, beta 2 Gene [Source:MGI (curated);Acc:Gabpb2-004]

 
Come back to gene ENSMUSG00000038766


For any suggestions or comments, please send an email to unitrap@crg.es