Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M005F05
Clone ID M005F05
Vector U3betageo
Project ggtc

Sequence tag M005F05
Sequence
GGAATTAACGGTCCAACAACNNTNNNNTTAAGTGGANNNNAAAGGACCTCANNNNCGGTGAACAAGCTGTCTTTACAGGA
TGAACATAAAGCCAAAAAACCAGCATNNAAAGGGGAGGAGGGTCAAGATGTCTTAGCTAGATGGTCAGATGGCTTGTTTT
ATCTTGGAACTATCAAAAAGATAAACATATTGAAACAGAGCTGCTTCATCATATTTGAGGACAGTTCCAAATCCTGGGTT
CTCTGGAAGGACATCCAAACAGG
Sequence Type mRNA
Unitrap ID UNI3145

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108509890..108510238 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es