Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12894G7
Clone ID IST12894G7
Vector VICTR76
Project tigm

Sequence tag IST12894G7HMF2
Sequence
TCANCAACCACATGGTGGCTCACAACCATCCGTAACAAGATCTGACTCCCTCTTCTGGTGTGTCTGAAGACAGCTACAGT
GTACTTACATATAATAATAAATAAATCTTTAAAAAATTCATAATAAATG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 147528..407571 109
NO GENE  


Sequence tag IST12894G7BBF1
Sequence
TCAGCAACCACATGGTGGCTCACAACCATCCGTAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI8644 UNI30731

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26417983..26418026 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 13927054..13927097 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20308862..20308905 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 32523982..32524025 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 34849562..34849605 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 55580674..55580717 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 100802920..100802963 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 6042430..6042473 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068270 (Shroom4) NM_001040459 shroom family member 4 Gene [Source:MGI (curated);Acc:Shroom4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 90551030..90551073 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051329 (Nup160) NM_021512 nucleoporin 160 Gene [Source:MGI (curated);Acc:Nup160-001]

 
Come back to gene ENSMUSG00000051329


For any suggestions or comments, please send an email to unitrap@crg.es