Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14566H2
Clone ID IST14566H2
Vector VICTR74
Project tigm

Sequence tag IST14566H2HMR1
Sequence
TCTCCAGCAAAAGGTGTAGCCCAGATTAAAGGTGTGTTCCACCACACCTTTAATCCCAGATGAAAGGCATAGCCCAGATT
AAAGGTGTGTTCCTTAACTCGGAGATTCAATCTTCTGGAATCCATAGCCACTATGGCTCAAGATCTTCAAACCAAGATCC
AGATAAGGATCTCCAAGCCTCCAGATAAGGGTCACTGGTGANCCTTCCAATTCCGAATTGTANTTCATTCCAAATATTGT
CNNGTTC
Sequence Type genomic DNA
Unitrap ID UNI30946 UNI31095

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 53993090..53993335 238
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36657499..36657744 238
 
EST/CDNA Est Name
  AA656659.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31819074..31819319 238
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022770 (Dlg1) NM_007862 discs, large homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Dlg1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 16878763..16879008 238
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 71224564..71224809 238
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 45777581..45777826 238
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 45463742..45463987 238
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 22724685..22724930 238
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 14976338..14976583 238
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 104438587..104438832 238
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 45000010..45000255 238
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 85821168..85821413 238
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 124093979..124094224 238
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 94777167..94777412 238
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 39594728..39594973 238
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 35325097..35325342 238
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 3269843..3270088 238
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 19960418..19960663 238
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 141821257..141821502 238
NO GENE  


Sequence tag IST14566H2BBF2
Sequence
GAGACAATATAAGGACATTGGAAGAAGGGAGTCTAGCTCTAGCTCTTGCTCTTGCTCCTTCGCCTGCTTGCTGCGTGAGA
CTGAGTAACTGCTAGATCCTTGGACTTCCATTCACAGCTGCGACTGAACCATTGTTGGGAATTGGGCTGCCGACTGTAAG
TCATCAATAAATTCCTTTACTATTTAGAAATTATCCATAAGTTCTGTGACTCTAGAGAACCCTGACTAATACAGAAGTTG
GTACCAGGAGTGGTTCTAGAGTAACAGAAGTACAAGGATGAATCTTTTAAAATTCTGGAATTGGCTTGTTGATCCACCAG
CACTTTCAACTATTGAAACCTCTCCAGATTCTCTCCCTCCTGGGAGCTCAGAGAATTTTGAAGACCCATGGTTGAAACTA
TATTCCGAACTTAAAGAAGCTAATGCCCTTGATTTTCTTAATGAATTANGTGATTCAGTGCACANAGCTTTCTACNAGAN
GGGGAAAAAATCGAAAAATGATTTTACTGGCTGGCTGCTCTTANTATCTGTGGAAAAAATGATGAATGAAAGGAAGGN
Sequence Type genomic DNA
Unitrap ID UNI2131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 84966203..84966759 547
 
EST/CDNA Est Name
  CN686268.1 - BB621855.1 - CF167930.1 - CF165343.1 - CJ067845.1 - BY012911.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44028007..44028563 547
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034342 (Cbl) NM_007619 Casitas B-lineage lymphoma Gene [Source:MGI Symbol;Acc:MGI:88279]


Sequence tag IST14566H2HMF3
Sequence
GAGACAATATAAGGACATTGGAAGAAGGGANNCNAGCTCTAGCTCTTGCTCTTGCTCCTTCGCCTGCTTGCTGCGTGAGA
CTGAGTAACTGCTAGATCCTTGGACTTCCATTCACAGCTGCGACTGAACCATTGTTGGGAATTGGGCTGCCGACTGTAAG
TCATCAATAAATTCCTTTACTATTTAGAAATTATCCATAAGTTCTGTGACTCTAGAGAACCCTGACTAATACAGAAGTTG
GTACCAGGAGTGGTTCTAGAGTAACAGAAGTACAAGGATGAATCTTTTAAAATTCTGGAATTGGCTTGTTGATCCACCAG
CACTTTCAACTATTGAAACCTCTCCAGATTCTCTCCCTCCTGGGAGCTCAGANAATTTTGAAGACCCATGGTTGAAACTA
TATTCCGAACTTAAAGAAGCTAATGCCCTTGATTTTCTTAATGAATTANNTGATTCAGTGCACAAAGCTTTCTACAAGAN
GGGGAAAAAATCGAANAATGATTTTACTGGCTGGCTGCTCTNANTN
Sequence Type genomic DNA
Unitrap ID UNI2131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 84966203..84966723 505
 
EST/CDNA Est Name
  CN686268.1 - BB621855.1 - CF167930.1 - CF165343.1 - CJ067845.1 - BY012911.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44028043..44028563 505
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034342 (Cbl) NM_007619 Casitas B-lineage lymphoma Gene [Source:MGI Symbol;Acc:MGI:88279]

 
Come back to gene ENSMUSG00000034342


For any suggestions or comments, please send an email to unitrap@crg.es