Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10895H7
Clone ID IST10895H7
Vector VICTR76
Project tigm

Sequence tag IST10895H7HMR1
Sequence
AGTCTATCTAGTGCCTATAATCCCAGCAATTCTGGAGGCCAAGGTAGGAAAATTTTAAGTTCAAAGCCAGCC
Sequence Type genomic DNA
Unitrap ID UNI21290

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181015617..181015688 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038705 (Gmeb2) NM_198169 glucocorticoid modulatory element binding protein 2 Gene [Source:MGI (curated);Acc:Gmeb2-001]


Sequence tag IST10895H7BBF1
Sequence
NNTATAGGCCNNANACACTACAAAGAATATTTTTAGTGTGCTAAAGAAAGTAACTGGCCAGTCAGATTTGATAGTTTACA
TCTGTAACCCCAACACTCTCAANACTAAGGTAAGGGGATTCCATGAGTTCTAAGCCAGCCTANAACTAGGCCANNTATAA
AATAANATCCTGTCTCANAAAGAAAAATAGGGAAAAGTATGGAAGGAAGAACANACNGACNGACTGATGAGTAGACAGGC
TCCCTACCCNNGTNTNTNTNNNNNGGCCNGCCAGGGGTTCAGCAGGTAAAGGCACTGCCNCCNANCTTGGNGATNTGNNT
TGNANNNNTANGACTTATATGGTAGAAGGAAANANTNNNNTTTCCTCAAATN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10895H7HMF2
Sequence
ACTATAGGCCACTAGACACTACAAAGAATATTTTTAGTGTGCTAAAGAAAGTAACTGGA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181015686..181015743 58
NO GENE  

 
Come back to gene ENSMUSG00000038705


For any suggestions or comments, please send an email to unitrap@crg.es