Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CA0090
Clone ID CA0090
Vector pGT0lxf*
Project sanger

Sequence tag CA0090
Sequence
AGCAAGAAGATGAAAGAGAAAAGAAAGATGAACTTCAGACAGAGTCGTGGTCAACAAAACATGAAATAGCT
Sequence Type mRNA
Unitrap ID UNI525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 15911099..15911169 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028224 (Nbn) NM_013752 nibrin Gene [Source:MGI (curated);Acc:Nbn-001]

 
Come back to gene ENSMUSG00000028224


For any suggestions or comments, please send an email to unitrap@crg.es