Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone F026A07
Clone ID F026A07
Vector pT1ATGbetageo
Project ggtc

Sequence tag F026A07
Sequence
GATACACCACTGCATTTTGCTTGTAAATTTGGAAATGTGGATGTAGTCAATGTGCTTTGTTCACACCCTTTGATTGTGAA
AAACCGAAAGAATAAATATGGTAAAACACCTGAAGAAGTAATTTGTGAAAGAAGCCAAAACAAATCTCCAGCACTGAAAG
AAAGGATTAGAGAATACTTAATGG
Sequence Type mRNA
Unitrap ID UNI12455

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 110670954..110673589 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029501 (Ankle2) NP_082198 ankyrin repeat and LEM domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1261856]

 
Come back to gene ENSMUSG00000029501


For any suggestions or comments, please send an email to unitrap@crg.es