Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13042F2
Clone ID IST13042F2
Vector VICTR76
Project tigm

Sequence tag IST13042F2BBF1
Sequence
NAATGATGTGGTGTAAGAAAAAGGAAAGTCTCTGTGTGTGCCTGTGTGTGTCTATGTAGGACCTCTGGAAGAGCAGCCAG
TGCTCTTAACTGCTGAGACACCTCTTCAGCCCCAAAGTAGTCACTGTATTTTGAAACTAGGCACCAGGCACTATGCTGCC
CCTAGGGCCCCATTGCAGAAACTGACAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13741106..13741296 191
NO GENE  


Sequence tag IST13042F2HMR1
Sequence
NCCTATTTCCTATTGAAAACCTTGAGTTATTCCTACTATGTTTCATCTGGGTTGCTCTTAACTCCNNTT
Sequence Type genomic DNA
Unitrap ID UNI16376

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 35379880..35379943 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037646 (Vps13b) vacuolar protein sorting 13B (yeast) Gene [Source:MGI Symbol;Acc:MGI:1916380]


Sequence tag IST13042F2HMF2
Sequence
TAATAAAACAATACTGAAAGAGAGCATACACCANACTAACTCGGGGACAGGGTTTGAGTATATGGGCTATGAGAATGTCA
AGGTTCCAGGAGGCTGAGTTTCCTTGAAACTCTTTGCCTTGTGACTGCCTCCAGGCCTTTCGACCGGACAGGCACACTTC
ACTGGAGTGGGTGTANCANGTCCCTAGCACCAACAGTAAGTAGTAAATACTAANGACTGCTTTAGCCNACAAATAAGAAT
TTTGTGTTGTATTTCCNAAGGATAGTGCNNGGGAATGGTGGTGCACACTTTTAATCCCAGCACTTGGGANGCANANGCAN
GTGGATTTCTGANTTTGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000037646


For any suggestions or comments, please send an email to unitrap@crg.es