Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone F017B08
Clone ID F017B08
Vector pT1ATGbetageo
Project ggtc

Sequence tag F017B08
Sequence
AGGGGCCGCAGCTCCTGGTTTTGCCAGATGTAGATGGCGACCTTCCCCCCGGGTCT
Sequence Type mRNA
Unitrap ID UNI12457

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 37298576..37298631 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050714 (Zbtb26) NM_199025 zinc finger and BTB domain containing 26 Gene [Source:MGI (curated);Acc:Zbtb26-001]

 
Come back to gene ENSMUSG00000050714


For any suggestions or comments, please send an email to unitrap@crg.es