Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone F017B06
Clone ID F017B06
Vector pT1ATGbetageo
Project ggtc

Sequence tag F017B06
Sequence
ATAGGATCTTGTATAATTTGATAGTCATTCGTAATCAGCAGACCAAAGACTCAGAG
Sequence Type mRNA
Unitrap ID UNI371

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 72238617..72238672 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039395 (Mreg) NM_001005423 melanoregulin Gene [Source:MGI Symbol;Acc:MGI:2151839]

 
Come back to gene ENSMUSG00000039395


For any suggestions or comments, please send an email to unitrap@crg.es