Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10921E1
Clone ID IST10921E1
Vector VICTR76
Project tigm

Sequence tag IST10921E1HMR1
Sequence
TNATCATGAGAGTAATTGTGGTCAAACCCAAGAGTTCCAATGAAAATCCCATGTCGTATGTTACATTTACATTTATTATT
TACATTATTTATAAACATTTTCTATTTTATTTGGACTTAAAATGTGTTTGACCAACTGCCAGTTTTAATATAATGGATGC
NTTANTGTCN
Sequence Type genomic DNA
Unitrap ID UNI18922

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101489923..101490089 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010362 (Rdm1) NM_025654 RAD52 motif 1 Gene [Source:MGI (curated);Acc:Rdm1-001]

 
Come back to gene ENSMUSG00000010362


For any suggestions or comments, please send an email to unitrap@crg.es