Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone F016B01
Clone ID F016B01
Vector pT1ATGbetageo
Project ggtc

Sequence tag F016B01
Sequence
TGCGCTNNTNNACAGCACANNCCGTCANNGCCGACCANGGCCGCAGCTCGCANNTCANNCCTCAGAGCGATTCGCCCCTC
ACGNNTCACCTCACTCGCAGCAAGCCCGAATCGACNNACAGAGAGCGCCCNNCCACCAGGCGCCCAGGCCCCCACGCGCC
CACCGGCCCCTCACCGCCCCGATGCCCAGNNCACTNNCACAACCANNNNCCTNNGCCAGNGCCATGCAGACCCCCCTGCC
CCCCTCCCTGCCTCNNAGGCCCACCCCNNCNCACAGCCNNNGCACAAGCACCCGCCTCCCCCGCNNAAGACAGACNCCCC
TCCACCGGNNNNGCATCGCACTCTCGACNNACCCCCTCCCCATCTCACCCGCACNNACANNNNCTCNNCGTCNNTCTCTC
CCTTCCCAGCGAATCNNTGTCGGGCGCGCCCGTTTTTATTTCCCCCGGGGCCCACGTGTTTTAGGGAAGAAGCGGACTTG
AGAGCGGTTGAGTTGCCCTTTGTGAAATTGTCGCATCGGAACATCGCCCGGCCTCGGTGCCCAGGAATTCACCATGCCTA
AAGGATTAAAAGGAAAATTGCTAGGGCGTGAAAAAAAAGTCACCCGTCGGTACAGTAGAAAAGCAGCTCAGATTACAAGA
GAGTCTCACAAACAAGACAAGAAGGAAAGATTGAAGACTGAGAAGGCCTTGCGTCTCAACCTTATTG
Sequence Type mRNA
Unitrap ID UNI12459

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 69006405..69010440 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025591 (1810029B16Rik) NM_025465 RIKEN cDNA 1810029B16 gene Gene [Source:MGI Symbol;Acc:MGI:1913532]

 
Come back to gene ENSMUSG00000025591


For any suggestions or comments, please send an email to unitrap@crg.es