Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone F015E03
Clone ID F015E03
Vector pT1ATGbetageo
Project ggtc

Sequence tag F015E03
Sequence
TTCCCGTNNCCCTTTGTTCAACTTGNNCGCCCNGCCNNNNCTCCCGNNNCTTACACTGCCCAGCNNANNTTAAGGGTTTN
NCACGGGCCAACCCCGGCTTNNNGGGCNNNNAAACTTTTGAAACCTATGGACACCCTAANTGATGTCAGTTTTAATCAGG
GNNCAGACCAATTCCACCTACGGGCAGGATTGCATATGAAAATNNNNACGGACANNCTCCCACTNGTTATAGCACTCCAA
CTGCCCCGCAGGCGTACAGCCNNCNTTTGCAGGGATATGGCACTGGGACTTATGACAGCACCACTNNTACAGTCACCACA
AACGCAGGCCTCTTACGCAGCTCAGACTGCATANNGCACCCAGCCTGNNTACCCCACCTATGGCCAGCAGCCAACAGCCA
CCGCACTTACCAGACCACAGGATGGTAACAAGCCTGCTGAGACTAGTCAACCTCAATCTAGCACAGGGGGTTATAACCAA
CCCAGCCTAGGATATGGACAGAGTAACTACAGCTATCCCCAGGTACCTGGGAGCTACCCAATGCAGCCAGTCACCGCACC
TCCATCTTATCCTCCTACCAGCTACTCCTCTTCACCAGCCGACTAGTTACGATCAGAGCAGTTACTGTCAGCAGAACACC
TATGGGCAGCCGAGCAGTTATGGACAACANNCGTAACTATGGTCAAAAAAGCACATGTGGGCAGCAGCCTCAGATTATTT
ACCCCCCTCAGAGTGGTTCTGACTGCCAGGNNCCAATTGTTGGATCGACTGGAGTGCATGGGATGAGGACCCCAAG
Sequence Type mRNA
Unitrap ID UNI12461

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4983402..4991972 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009079 (Ewsr1) NM_007968 Ewing sarcoma breakpoint region 1 Gene [Source:MGI (curated);Acc:Ewsr1-002]

 
Come back to gene ENSMUSG00000009079


For any suggestions or comments, please send an email to unitrap@crg.es