Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10967H11
Clone ID IST10967H11
Vector VICTR76
Project tigm

Sequence tag IST10967H11BBF1
Sequence
AAGGTATAAGGTGAGTGGCCTCATCTTAACTGTGCAGTTTTCACCTCCTTCCTCATCAATCCCACCAATGTTGTTTTTCC
ATCCAGAATCAGGTAAAATCAGTCTGTCAGTCATCTCGCTGCCCTTGCTATCATCACAAGCTTTAAAAACAATGTTTTTG
TAACANAGTTCTCTGGTCACATTTTGGTTTCTGAAGAGGTGTGGCTCACAAACTCACACCANCCTCNTTGCTCCTGCGTC
AGCTTCTTCTCCTGATGGCTGTTGTTCCTTGACTCNNTTGNGTTCCTATTTNTAAAAANGANCGATGCCAGGATTATGAC
CNTCACTCCTTCCTGGGACAGGCATGTCATATANACTGTTCTGCATTGTGACTAANANAATTTTTAAAAAAGTCANAN
Sequence Type genomic DNA
Unitrap ID UNI16635

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 50149750..50150144 369
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073207 (6330534C20Rik) NM_001034059 RIKEN cDNA 6330534C20 gene Gene [Source:MGI Symbol;Acc:MGI:3588225]


Sequence tag IST10967H11HMF1
Sequence
AAGGTATAAGGTGAGTGGCCTCATCTTAACTGTGCAGTTTTCACCTCCTTCCTCATCAATCCCACCAATGTTGTTTTTCC
ATCCAGAATCAGGTAAAATCAGTCTGTCAGTCATCTCGCTGCCCTTGCTATCATCACAAGCTTTAAAAACAATGTTTTTG
TAACAGAGTTCTCTGGTCACATTTTGGTTTCTGAAGAGGTGTGGCTCACAAACTCACACCAGCCTCGTTGCTCCTGCGTC
AGCTTCTTCTCCTGATGGCTGTTGTTCCTTGACTCGCTTGTGTTCCTATTTCTAAAAAGGAGCGATGCCAGGATTATGAC
NNTCACTCCTTCCTGGGACAGGCATGTCATATAGACTGTTCTGCATTGTGACTAAAAGAATTTTTAAAAAAGTCAGAAAA
TTCTATTTCTAGAAAAAAAACCNCGATTCTGACNANTGTGCGCCATGGATTTCTTGNTTGAGTTTGTNNATAANAACCNG
GGGATGAAAACCNNNATTTGTTACNCAGTNNNAANCACCCCTGTCNCTGAGNANNNATTCCNNCCTGANNAGCN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000073207


For any suggestions or comments, please send an email to unitrap@crg.es