Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14185D6
Clone ID IST14185D6
Vector VICTR74
Project tigm

Sequence tag IST14185D6BBF1
Sequence
TCCTATGCCCNNNNCNATCCTTTTTCTTTGATCTGCCTACTACACACCCTCTTCAGCCGAACGAAAGGCAAAACAGGAAN
AGGCTGGAGCCTTCTCATAAACCGGATGGAGGGTGAGGAGGGTGGATGGTCGAGGTCTCTGGGCACAAAGGCTTCAGAAG
AGAGTACCACTATCACTCAGCTCANACATCTGTCTTTCAGCACTCCGAGGGCCTGGGGGCCGCTCCATTATCAATGGGAA
CTGGGCTGTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI33205

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95485302..95485555 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015850 (Adamtsl4) NM_144899 ADAMTS-like 4 Gene [Source:MGI (curated);Acc:Adamtsl4-001]


Sequence tag IST14185D6HMR1
Sequence
AGGACCGAGGTCCTCTTTCTTACCGAGGTAATTGGAACTGGGTCGCAACTGGGAAATGTGAAGGTGGGAGGCCCCGGCAG
GGATCCACAGGATCTTCTGATAGCCCAAGGGGCCCCCTCGGTCAGTGAGATTTCCCGAAACCAGGCGGCAGGTANAACCA
TCACCCCCGCAGACTCCGCAGCCATCCGGACGCCTGCCAGAGCCAAGGACCCNATCACAGCCNGGGCTCTGGGGAGAGTG
AGGTGANGCAGGGGCCACACANACGCCNNGCATCCCTCNNANNNGGCNNNGCTCCNCCNNGGGCNCTNNNCTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000015850


For any suggestions or comments, please send an email to unitrap@crg.es