Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14506A12
Clone ID IST14506A12
Vector VICTR74
Project tigm

Sequence tag IST14506A12HMR1
Sequence
GTGGGACATATAGAATGGAGATGTCAGAGATCTCTTTGGGTATACAAGGGCCTGATAAAGTAACAGAATAATTCTAATTT
TAGAGAAGGCAAGTGGTGTGGAAAACCACTGGAGGAAGCTTTGCTTCTGTTTGTATTTCTGGGTAGAGACAGGAGGACTG
CCTTGGGGTCTCTAGGANAAAGGAAGCTTGGTAGTAGTTAAATCCTCANCC
Sequence Type genomic DNA
Unitrap ID UNI33209

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 94758712..94758919 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005774 (Rfx5) NM_017395 regulatory factor X, 5 (influences HLA class II expression) Gene [Source:MGI (curated);Acc:Rfx5-004]

 
Come back to gene ENSMUSG00000005774


For any suggestions or comments, please send an email to unitrap@crg.es