Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone F009E08
Clone ID F009E08
Vector pT1ATGbetageo
Project ggtc

Sequence tag F009E08
Sequence
TTGGCTTCGGGTGACAAGGGTCAGAGATGAAGGTGGCCGCGGCTCAGCGGGGAGTAGTGCTGCGCCGGGCGCGGTTGGCA
GCCAGGCCGCGCCTGTAGGACCTCCGGGCCGGGGTGGCGGGATGGGGACCCGACTCGGGTAGAAAAGCGGGGACAGCAGA
GAGCAGAACTTAAGCCCGAGGGGCTCGCCTGCTCCGGTCACACTCGGAGTCCTCTTCCACCTGCTGCCGCTCGGTCCCGC
GTCCGGCGGGCCACGACGGCGTCGGCGACGGCGGGGGCATGTGGCGCTGGGTCCGGCAGCAGCTG
Sequence Type mRNA
Unitrap ID UNI12465

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 35653031..35653332 298
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037400 (Atp11b) NM_029570 ATPase, class VI, type 11B Gene [Source:MGI (curated);Acc:Atp11b-001]

 
Come back to gene ENSMUSG00000037400


For any suggestions or comments, please send an email to unitrap@crg.es