Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14563B8
Clone ID IST14563B8
Vector VICTR74
Project tigm

Sequence tag IST14563B8HMF1
Sequence
GCAGTTTGGGTGGATCCCCGGGACCTAGCTTGACCTTCCTGCTTACCTTTCTTCCTGACGGTCTCCCACTTGCTTTAGGC
TTCCTCTCTTCCAATCAGTTGAACTGGCCTCTCCTTCCCTGCCACATGCCCTCTAGGCCCCAAGACTCTCCTTTCCTCGC
TCTTTTTAACATTCAATCATGCCTTGCACCTTGAGGATGGGCTGCCCACCCTGACACCTGTCTTGTTAGGCTCACTCCAC
CCTACATGGATTCCAGCCCTTCCACCTCCCTGACTCAGCTCACCTCCACGGTGGGCAGCCAGGCGGATAGGGAAGACGGG
AGCCCGCGGCGTGTGCANCANATGANGTCGGCGCANGAANAANATGGANAGCATGACGTAACTGCCCAGGGTGGGCANAA
CAAAGTACAGGAGANGGATCATAGCCTCGCTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 133909974..133910406 415
NO GENE  


Sequence tag IST14563B8HMR1
Sequence
CTGCTTTCNNCAGGGTCTGGGGAGCGACTGGAGAACACCATGGAAGCAGTAGAGAAGTGANTCCAAGCCCCATCAAGTTC
CATGTGAGGTTGTGGGGTTGTGGGCTGTGCTCTGCAGGACAACCAGGAGTGCTACTTACTCGCTTCATAAACTGGGTATC
TGGAAGTCCTTGGAACTGTGGAAC
Sequence Type genomic DNA
Unitrap ID UNI15392

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 133910403..133910586 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030703 (Gdpd3) NM_024228 glycerophosphodiester phosphodiesterase domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1915866]

 
Come back to gene ENSMUSG00000030703


For any suggestions or comments, please send an email to unitrap@crg.es