Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14564G10
Clone ID IST14564G10
Vector VICTR74
Project tigm

Sequence tag IST14564G10HMR1
Sequence
GATATAAAATGGAGAGTGCCAAGAACAAACATGTCAGTGTATGTGCGTATGTGACTGAGAAAAACAAACCTAGGCCATAG
ATTAACCCACTTTGTGACCTACCTGAAAAGATATTTAGGTGTCCCTTCTGTGCCAGGAGACCAACTCATGGAATGGGCCT
GCCTTATGGTAAGGTTTACTAGTCCCTACATTTCATCTTCCCTCCTCCCTGCCTTCCTANACAGTCTTANTATCTAGACT
GAGGCCATAATCCGAGCATGTGGGAAACAGATGCAGATGTTGTTGAAGGTCNNCCTGGTCTACAGAATGAGTTCCAAGAC
ATACNGANTGACAAAAGGAGAGAGGGGAAAAAATATTTAANACTGACCTGGAACTNACCTANGACTTTATTTANTTATTT
ATTTAGAGACNGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGANCTCACTTTGTAGATGANGCTGTNNATGANGAN
Sequence Type genomic DNA
Unitrap ID UNI21290

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181021265..181021739 443
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038705 (Gmeb2) NM_198169 glucocorticoid modulatory element binding protein 2 Gene [Source:MGI (curated);Acc:Gmeb2-001]

 
Come back to gene ENSMUSG00000038705


For any suggestions or comments, please send an email to unitrap@crg.es