Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W027D03
Clone ID W027D03
Vector pT1betageo
Project ggtc

Sequence tag W027D03
Sequence
CTGCACACCCGCTGCCCGTGCAGCCAGAGGACCCAGCACCTCTCGGGGGGTTCTCCGTCCTCGGCGCTTGGAAGAACGGA
TCTTTTTTCTCGGAGAAAAGTTCACTGGAACTGGAAGAAATGGATTTATCTGCCGTCCAAATTCAAGAAGTACAAAATGT
CCTTCATGCTATGCAGAAAATCTTAGAGTGTCCGATCTGTTTGGAACTGATCAAAGAACCTGTTTCCACAAAGTGTGACC
ACATATTTTGCAAATTTTGTATGCTGAAACTTCTTAACCAGAAGAAAGGGCCTTCACAATGTCCTTTGTGTAAGAATGAG
ATAACCAAAAGGAGCCTACAGGGAAGCACAAGGTTTAGTCAGCTTGCTGAAGAGCTGCTGAGAATAATGGCTGCTTTTGA
GCTTGACACGGGAATGTAGC
Sequence Type mRNA
Unitrap ID UNI5548

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101395253..101413183 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017146 (Brca1) NM_009764 breast cancer 1 Gene [Source:MGI (curated);Acc:Brca1-001]

 
Come back to gene ENSMUSG00000017146


For any suggestions or comments, please send an email to unitrap@crg.es