Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10124B10
Clone ID IST10124B10
Vector VICTR76
Project tigm

Sequence tag IST10124B10BBR1
Sequence
TGGGTGGCAAGGCCACAGTGTTCTGAGTGTTCCCAACAAGGTTCATGAAGGTTTGTTGGGTGGTAACTCCATTTTTTTTT
TTTTTTA
Sequence Type genomic DNA
Unitrap ID UNI33211

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 138537157..138537242 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040167 (Ikzf5) NM_175115 IKAROS family zinc finger 5 Gene [Source:MGI (curated);Acc:Ikzf5-001]

 
Come back to gene ENSMUSG00000040167


For any suggestions or comments, please send an email to unitrap@crg.es