Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10652B3
Clone ID IST10652B3
Vector VICTR76
Project tigm

Sequence tag IST10652B3HMF1
Sequence
GGAATGTTATCGGCCACAAAAGCCGTGGTACATTGAAGGCTAGTGTGTTCTGTTA
Sequence Type genomic DNA
Unitrap ID UNI4925

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71174972..71175025 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027010 (Slc25a12) NM_172436 solute carrier family 25 (mitochondrial carrier, Aralar), member 12 Gene [Source:MGI (curated);Acc:Slc25a12-001]


Sequence tag IST10652B3BBF1
Sequence
GGAATGTTATCGGCCACAAAAGCCGTGGTACATTGAAGGCTAGTGTGTTCTGTTGACTCCAAGCTCCTAGGTCTGTCAGT
GAGATCTGTC
Sequence Type genomic DNA
Unitrap ID UNI4925

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71174937..71175025 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027010 (Slc25a12) NM_172436 solute carrier family 25 (mitochondrial carrier, Aralar), member 12 Gene [Source:MGI (curated);Acc:Slc25a12-001]

 
Come back to gene ENSMUSG00000027010


For any suggestions or comments, please send an email to unitrap@crg.es