Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14162A7
Clone ID IST14162A7
Vector VICTR74
Project tigm

Sequence tag IST14162A7HMR1
Sequence
AGATCTCATTACAGGTGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGAACTCAGGGCCTTCAGAAGAGCAGTCNNNGN
GCAN
Sequence Type genomic DNA
Unitrap ID UNI17456

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26719273..26719347 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072681 (Plac9) NM_207229 placenta specific 9 Gene [Source:MGI Symbol;Acc:MGI:2663998]


Sequence tag IST14162A7BBF1
Sequence
ATCTGACGCCCTCTTCTGGTGTGTCTGAAGACAGTGTANTTATATATAATAATAAATAAATCTTTGGGACTGAGTGAGCA
NAGTTAACTGGAGCTAGTGGGGCCAACCANANCGAGCANAGGTCCTAAAATTCAATTCCCAACAATCACATGAAGGCTCA
CAACCATCTATACAACTACAGTGTACTCACATACATAAAATAAATAAATCTTAAAAAAAAANNTNNGGGANTCNGGCNNT
AATGATNCNNGCNNNGNTCNCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14162A7HMF2
Sequence
ATCTGACGCCCTCTTCTGGTGTGTCTGAAGACAGTGTANTTATATATAATAATAAATAAATCTTTGGGACTGAGTGAGCA
GAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26719344..26719428 83
NO GENE  

 
Come back to gene ENSMUSG00000072681


For any suggestions or comments, please send an email to unitrap@crg.es