Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14492G6
Clone ID IST14492G6
Vector VICTR74
Project tigm

Sequence tag IST14492G6HMR1
Sequence
ATTCTATTATACTGCAAACATTGGAGGTCGTATTGTTATGTCTCAATCACCCATGCATCCTGTCTTAGTTACTGTTCTAT
TGCTGAGCAGAGACACCACGAGCAAGGCAACTCTTATCAAAGTAAGCATTTAATTGGAGTTTGTTTATAGTTTCAGAGGG
AAGCAGGCAGGCATGGCTCTGAAGCAGTGGATCGATAGCATCCAGACCCACAGGCTGCAAGGAGAGAGAGAGAGAGAGAG
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAN
Sequence Type genomic DNA
Unitrap ID UNI7146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56863052..56863328 277
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038816 (Ctnnal1) NM_018761 catenin (cadherin associated protein), alpha-like 1 Gene [Source:MGI (curated);Acc:Ctnnal1-001]


Sequence tag IST14492G6BBF1
Sequence
GAATAACAATTCAATCACAAAATATATTTCATAGATGAGATAAAACTAAAAAAATGAGGAAACAGTGAATGATGAAAAAA
GATCTGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56863325..56863411 87
NO GENE  


Sequence tag IST14492G6HMF1
Sequence
GAATAACAATTCAATCACAAAATATATTTCATAGATGAGATAAAACTAAAAAAATGAGGAAACAGTGAATGATGAAAAAA
GATCTGTGCTACATTCAAATGATGAACCACAGTACTAAAGAAATAATTTTAATGGATGTTCTATGCAAAATATAACAACA
TGATACTGTGCCCAGGAAGCCTCCTGAGATTGGCTGCTCTTTCTTCTCTGANAGAGTGGACTTGATAGTAGCAGGCTGGT
AACCTCAGGGATGATGGATTTCATAAAACAGAAACTGAGGGGTGAGGGGCTCTGGGGGCGANCCTGTCCTGTCNNNGACT
GN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56863325..56863645 311
 
EST/CDNA Est Name
  CJ062365.1 - CJ067532.1 - CJ160054.1 - AW319020.1 - BB861699.1 - CJ094037.1 - CJ071087.1 - CJ071042.1 - CJ055446.1 - CJ071083.1 - CJ069307.1 - BY015634.1 - BY066912.1 - BY017544.1 - BY309516.1 - BY019096.1 - BY300501.1 - CJ055526.1 - BY016871.1 - CJ137696

 
Come back to gene CJ062365.1 - CJ067532.1 - CJ160054.1 - AW319020.1 - BB861699.1 - CJ094037.1 - CJ071087.1 - CJ071042.1 - CJ055446.1 - CJ071083.1 - CJ069307.1 - BY015634.1 - BY066912.1 - BY017544.1 - BY309516.1 - BY019096.1 - BY300501.1 - CJ055526.1 - BY016871.1 - CJ137696


For any suggestions or comments, please send an email to unitrap@crg.es