Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14433H2
Clone ID IST14433H2
Vector VICTR74
Project tigm

Sequence tag IST14433H2HMF1
Sequence
GTGAGCACGGGGAATTGGGTGCGGCGGAGCTCGGGTCCGCTAGGCCGCGGGTGGCCAGC
Sequence Type genomic DNA
Unitrap ID UNI11353

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 116485434..116485491 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020806 (Rhbdf2) NM_172572 rhomboid 5 homolog 2 (Drosophila) Gene [Source:MGI (curated);Acc:Rhbdf2-001]


Sequence tag IST14433H2BBF1
Sequence
GTGAGCACGGGGAATTGGGTGCGGCGGAGCTCGGGTCCGCTAGGCCGCGGGTGGCCAGGGATTCACGGGGCTGCCCCGTT
CGGCCGCGGGGAAGGTCGGGGGCTGTGCGCCCCGCAGAGCGCCCTAGAGGCCGAGGCTGGACTCTGTGCCCGCGGGACCG
CTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI11353

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 116485325..116485491 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020806 (Rhbdf2) NM_172572 rhomboid 5 homolog 2 (Drosophila) Gene [Source:MGI (curated);Acc:Rhbdf2-001]

 
Come back to gene ENSMUSG00000020806


For any suggestions or comments, please send an email to unitrap@crg.es