Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14572D9
Clone ID IST14572D9
Vector VICTR74
Project tigm

Sequence tag IST14572D9HMF1
Sequence
CTANNTNNNANNNNANGGACNNCTCACACNNNNNACNANTTACANANCTTGANATCATGTTAAGANCNNGTNANACTCTA
ACANAGGACCTGANTTTGGTTTTTANCACCCACATTTGATAGCTCATAACCTCCAGCTCCAGCTCCAGGGGATGCTATAC
CCTCCTCTGGATTTCTGTGGGTACCGACATTCANGAGCACATGTCACCCCCTAACCTCCCATACATATGCATAATTTAAA
ATAACCAAAACCAAATCTATAAACACACAATTTACAGGTCAGGCATGATAGTGCTTGTCTATAATTTTAGCCTTCCAGAN
ATAGCAGANACAGGAGGATCACCAGGAGTTAAAAGTCNNGCTGANTTATGTANCTGGTTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14572D9HMR1
Sequence
ANAAACATCNANAACANATGGGGCTATGATTCTGAGGTTCAGAGGACCAGTGTGAGCCTGGGATAAGGACTTCAAACTGG
ACATGATGGTATAGGACTATNTGCTCCCAGCACGAGGGAGGTGGAGGCAGGAACAGAAGTTCAAGGTTATCTTCAGCTAC
ATTATGTATGAGACCAGCCTANACTACATGANCCTCTTCCTCTTAATTAATTACTTANTCAATTTAAACCCANAACTGAT
TTCTAGGCCTACCAGGAAGTGGTGAGCCTTCANGAAAAGACTGCTTAANCTTTGTTGAGCATGC
Sequence Type genomic DNA
Unitrap ID UNI14590

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4606302..4606602 281
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009076 (Zmat5) NM_026015 zinc finger, matrin type 5 Gene [Source:MGI (curated);Acc:Zmat5-001]

 
Come back to gene ENSMUSG00000009076


For any suggestions or comments, please send an email to unitrap@crg.es