Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14797H7
Clone ID IST14797H7
Vector VICTR76
Project tigm

Sequence tag IST14797H7HMF1
Sequence
ATATACTGGAGAATGTCCTTGAACTTCTGTTCTTCCTGCCTTCACCTCCACTGAGTGCTCCAGGCTATTGGGTGTGCTGC
AAAGCCCAATATCTACAATGCTGGTGCTCAAACGCTGAGCTTTGAGTAAGAATAGGTTTTTGGGTATGGAGAGAGAGTGG
AGGATCTGAGCTGGGTGCCAGCACTCAAGTTCCAAAGCTTGTAATTGCCTGTTAATTCCAGCTACAGGGGAGCCAATCCT
CTGGCCCCTGTGGACGTACTTGTATATACTTCCCTCACACACTTATACAAANTACAAATAATTNAAATCNGTNAAGTAAA
TCTTANAAAGGAAGAAAAGANCATGGTCTACCATGANCANTTACCCTCANCCCCAAGAACNACTGTGCTTGCTCGTACAC
NCACACACNCNCNCNCNCACACACACNCACNCACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14797H7BBF1
Sequence
ATATACTGGAGAATGTCCTTGAACTTCTGTTCTTCCTGCCTTCACCTCCACTGAGTGCTCCAGGCTATTGGGTGTGCTGC
AAAGCCCAATATCTACAATGCTGGTGCTCAAACGCTGAGCTTTGAGTAAGAATAGGTTTTTGGGTATGGAGAGAGAGTGG
AGGATCTGAGCTGGGTGCCAGCACTCAAGTTCCAAAGCTTGTAATTGCCTGTTAATTCCAGCTACNGGGGAGCCAATCCT
CTGGCCCCTGTGGACGTACTTGTATATACTTCCCTCACACACTTATACNAAATACNAATAATTAAAATCAGTAAAGTN
Sequence Type genomic DNA
Unitrap ID UNI29686

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23809647..23809963 311
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041319 (Thoc6) NM_001008425 THO complex 6 homolog (Drosophila) Gene [Source:MGI (curated);Acc:Thoc6-001]

 
Come back to gene ENSMUSG00000041319


For any suggestions or comments, please send an email to unitrap@crg.es