Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11303G8
Clone ID IST11303G8
Vector VICTR76
Project tigm

Sequence tag IST11303G8HMF1
Sequence
ATAGGTCGTTTACTTTGGTTCTTGATTTTAAATCTGAAAAGTCCCTGTTTTGAGGGGTTATTAATGTGAATTTTTCACTT
TANCGTGTCATCTGAAATGCTGAAATTCCTTTTCAGTGTCCGAAAAGTACATTTGGCTTCTGCAGCANAGCCTGTTGATG
CTTCCCTACGGAATACTGCTAAAGAAAGGCAA
Sequence Type genomic DNA
Unitrap ID UNI33227

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12750619..12750809 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031010 (Usp9x) NM_009481 ubiquitin specific peptidase 9, X chromosome Gene [Source:MGI (curated);Acc:Usp9x-001]


Sequence tag IST11303G8BBF1
Sequence
ATAGGTCGTTTACTTTGGTTCTTGATTTTAAATCTGAAAAGTCCCTGTTTTGANGGGTTATTAATGTGAATTTTTCACTT
TAGCGTGTCATCTGAAATGCTGAAATTCCTTTTCAGTGTCCGAAAAGTACATTTGGCTTCTGCANCANAGCCTGTTGATG
CTTCCCTACGGAATACTGCTAAAGAAAGGCATCCCACATANCCCTCACATTTACTTATGTTTACTGAAACAGCCNACCTC
TGTANCTNANNCTGGTCTGGAATTCACTGTAATCAGGGTGACCTCNAACTGACCTTTTGTCACAGCCTCCCAAATGCTAN
GTTTNCAGCTGATTTTCCTGTTCATCCTTCTTGCCCCACTTTTTAAGCAGAATAANGGANAAGTGTANTANTNTAAACTA
TGTGCCTATGAACCTACCACTTANGAAGATCNNGAGTTCACGGTCATCATCTACTTAAATGTANNCTAAAAGCCCTACCT
CAAAACTAAAAGCCNAATNNAATACNAAATTCTTCCCTTTTANCAAACTNATTTANTGGCCNNCTTATGTTNNANNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031010


For any suggestions or comments, please send an email to unitrap@crg.es