Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M065B03
Clone ID M065B03
Vector ROSAbetageo
Project ggtc

Sequence tag M065B03
Sequence
GCTCGGCCCGGATCGCCGTGAAGAAGGCGCAGTTGCGCTCTGCTCCGCGGGCGAAGAAGCTGGAGAAACTCGGCGTGTAC
TCCGCCTGCAAG
Sequence Type mRNA
Unitrap ID UNI2494

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53706812..53706903 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000708 (Kat2b) NM_020005 K(lysine) acetyltransferase 2B Gene [Source:MGI Symbol;Acc:MGI:1343094]

 
Come back to gene ENSMUSG00000000708


For any suggestions or comments, please send an email to unitrap@crg.es