Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12322D12
Clone ID IST12322D12
Vector VICTR76
Project tigm

Sequence tag IST12322D12BBF1
Sequence
ATATCTCCCCACCATAAGATTTCAGTCTGCCATATTTTATCAAAATGTTATTCATATGACATAATCCCCACACTTGTAAA
AGAATGACAAATCTGAGACCAGCTGTGGGTACACAGCCTTATCTTGGAAGAGAGAGAGAGGTGATAAAAACAGGGCATAT
ATATAATCACATATGCATGTGCACACACATCTACATATACACACCATTCATGTAGTCCTTCAAAAAACATTAAGGGCAAT
AAAACTACATTTAAGAATCTAAN
Sequence Type genomic DNA
Unitrap ID UNI33229

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91704501..91704762 262
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074911 (AC131691.4) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q3TUQ9]


Sequence tag IST12322D12HMF1
Sequence
ATATCTCCCCACCATAAGATTTCAGTCTGCCATATTTTATCAAAATGTTATTCATATGACATAATCCCCACACTTGTAAA
AGAATGACAAATCTGAGACCAGCTGTGGGTACACAGCCTTATCTTGGAAGAGAGAGAGAGGTGATAAAAACAGGGCATAT
ATATAATCACATATGCATGTGCACACACATCTACATATACACACCATTCATGTAGTCCTTCAAAAAACATTAAGGGCAAT
AAAACNACATTTAANAATCTAAAAGTTTTTTTTTTTNAN
Sequence Type genomic DNA
Unitrap ID UNI33229

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91704501..91704776 272
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074911 (AC131691.4) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q3TUQ9]

 
Come back to gene ENSMUSG00000074911


For any suggestions or comments, please send an email to unitrap@crg.es