Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11078F12
Clone ID IST11078F12
Vector VICTR76
Project tigm

Sequence tag IST11078F12BBF1
Sequence
GGGAGGCAGAGGCAGGCGGATTTCTGAGATCAAGGCCAGCCTGGTCTAT

Sequence Type genomic DNA
Unitrap ID UNI33232 UNI33233

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71613603..71613650 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024053 (Emilin2) NM_145158 elastin microfibril interfacer 2 Gene [Source:MGI Symbol;Acc:MGI:2389136]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 105128388..105128435 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046169 (Adamts6) NM_001081020 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 6 Gene [Source:MGI Symbol;Acc:MGI:1347348]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 109641519..109641566 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 120181203..120181250 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 27181622..27181669 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 14483172..14483219 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 12083278..12083325 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 134198609..134198656 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 46989102..46989149 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 19866373..19866420 48
NO GENE  

 
Come back to gene ENSMUSG00000046169


For any suggestions or comments, please send an email to unitrap@crg.es