Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13155H12
Clone ID IST13155H12
Vector VICTR74
Project tigm

Sequence tag IST13155H12HMF1
Sequence
TGACNAAGACCCTAAGCAGGGCCTGACTTGGTGCTGGGTGGGAGTC
Sequence Type genomic DNA
Unitrap ID UNI22236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80882073..80882117 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055053 (Nfic) NM_008688 nuclear factor I/C Gene [Source:MGI (curated);Acc:Nfic-004]


Sequence tag IST13155H12BBF1
Sequence
TGACCNAGACCCTAANCAGGGCCTGACTTGGTGCTGGGTGGGAGTGGCTGGACGGGGCGTGGTCACTCCAGTCTACTTTG
TACAGGATGAGCTAAAGGTTATGGGATGGGACAGCCATGGCTCTGCCCACTTCTAATCCTAGTTGAGTTGGGGCCCCCCA
ANTAGGCTTCAGGGTAGGTTANAGCCTTAATGGGACCCCGAACTGCTGTTGGGTANTCCGGCANAACTTANAGGCANAGG
CAGGGGAACTGCTGTGAGGTGACAGTGGCTCACGCTCTTCCTGANGCTTTANAANCCACCCATGTACCCCANTACCCACA
TTGCTGGCGTAGGTCACTGCCTGAN
Sequence Type genomic DNA
Unitrap ID UNI22236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80881774..80882117 320
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055053 (Nfic) NM_008688 nuclear factor I/C Gene [Source:MGI (curated);Acc:Nfic-004]

 
Come back to gene ENSMUSG00000055053


For any suggestions or comments, please send an email to unitrap@crg.es