Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A023B02
Clone ID A023B02
Vector pT1betageo
Project ggtc

Sequence tag A023B02
Sequence
TTTTNNNTTTTTCCGGGTTCGGAGCCATTCCGGATGCTTTAGGCTGCCGGATGTCTGATCTCCGGATAACTGAGGCGTTT
CTGTACATGGATTATCTGTGTTTTCGAGCGCTTTGCTGCAAGGGACCACCACCTGCGCGCCCTGAATATGACTTGGTTTG
CATAGGTCTCACGGGCTCCGGGAAAACCAGCCTGCTGTCCGAGCTCTGCAGCGAAAGCCCGGAGAACGTTGTGTCGACCA
CAG
Sequence Type mRNA
Unitrap ID UNI12489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114584807..114712599 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042348 (Arl15) NM_172595 ADP-ribosylation factor-like 15 Gene [Source:MGI Symbol;Acc:MGI:2442308]

 
Come back to gene ENSMUSG00000042348


For any suggestions or comments, please send an email to unitrap@crg.es