Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13942G3
Clone ID IST13942G3
Vector VICTR74
Project tigm

Sequence tag IST13942G3HMF1
Sequence
TTGTACATGAAAATACATGGCCCTGGTCACTGTGAATATGTCTTGCTGTCTTTACGGGACTCTANACTGAAACCTCCAGG
TCTTGACTTTTTGGCCCACGTCATACAGCACGTACTTTGCACAGCCCGTANTTGTTGAAAGAATAAAAGAGTGCCCATAA
GCCAGGGTGTTGGGCCTTTGCTCCANCAAATACCCTTGGGTAATATGGCCCCCANCTCTCTCCCANANGATCACANAAAA
GCTGTGATATGTTTTCCTGACCNACAACCTGTGGTGGGACAGTTC
Sequence Type genomic DNA
Unitrap ID UNI33241

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 54841453..54841735 265
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000076928 (A430107P09Rik) T-cell receptor alpha C gene segment [Source:IMGT/GENE-DB;Acc:TRAC]

 
Come back to gene ENSMUSG00000076928


For any suggestions or comments, please send an email to unitrap@crg.es