Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W174F02
Clone ID W174F02
Vector ROSAbetageo
Project ggtc

Sequence tag W174F02
Sequence
CTATTTAAGAGAACAAAGAAACTCTCAAGTTTACCTTCGGATCATACTGGGAGCCAACGCCCATCTACTGCCTTGTAACC
TTNNNNTTCTTCTATTCCTCTGCCTCATTCTGGGCCTGGATGGCCCTGGGCTTTAGCTTGGCCGTGTACGGGGCCAGCTA
CCACTCTATGAGCTCGATGGCTCGGGCATCCTTCTCTGAGGATGGGTCCTTGATGGATGGTGGCATGGACCTCAAACATG
GAGCAGGGCATGGCAGAGCACCTTAAGGATGTGATCCTACTGACAGCCATTGTTCAGGTGCTCAGCTGTTTCTCCCTCTA
CATCTGGTCCTTCTGGCTTCTGGCTCCAGGNNGGGGCCCTTTACCTTTTGTGGGTAAACGTGCTGGGCCCCTGGTTCACA
GCAGACAGTGGAGCCCCTGCACCAGAGCTCAATGAGAAACGACAACGCCGACAGGAGCGGCAGCAGAATGAAAAG
Sequence Type mRNA
Unitrap ID UNI12498

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107850988..107852802 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014856 (Tmem208) NM_025486 transmembrane protein 208 Gene [Source:MGI (curated);Acc:Tmem208-003]

 
Come back to gene ENSMUSG00000014856


For any suggestions or comments, please send an email to unitrap@crg.es