Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10900A5
Clone ID IST10900A5
Vector VICTR76
Project tigm

Sequence tag IST10900A5BBF1
Sequence
GGGCCNAGAAATAAATCAGCCGGCTAGCTTAACGAGCAGGCCTACAGAAACGTGGCGTGCCGAGGCTTTTCTGCCTCTCC
TGGATCAAAGCTGCTAGAAATCTCTTTCTGGAAAAGAGTCTCCTCTCCGGATCT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4998104..4998236 131
 
EST/CDNA Est Name
  CA531769.1


Sequence tag IST10900A5HMR1
Sequence
GGCCCTATTGAGGCCNNGGGAAGAGACCCATAGCGGATTTTGAAAGTCCAGGGCGGGAACTCTAGAATGTGATGGTTATG
TTGTGGTCCTTACCGANAGAATAAGTGTAGCCTAGCCCTCACCTGCAGTTTANAATACAGTTC
Sequence Type genomic DNA
Unitrap ID UNI7060

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4997967..4998108 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009079 (Ewsr1) NM_007968 Ewing sarcoma breakpoint region 1 Gene [Source:MGI (curated);Acc:Ewsr1-002]


Sequence tag IST10900A5HMF1
Sequence
GGGCCNAGAAATAAATCAGCCGGCTAGCTTAACGAGCAGGCCTACAGAAACGTGGCGTGCCGAGGCTTTTCTGCCTCTCC
TGGATCAAAGCTGCTAGAAATCTCTTTCTGGAAAAGAGTCTCCTCTCCGGATCCAGACGGACCTTGTTATACAACCGATC
CCCCGCGCCGGTTGCTGAGAAAAGGACACTGGGAAGCCACTGCTTTTTGGGTAGGGAAGGAGGTGGAGTTAACG

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4998104..4998336 231
 
EST/CDNA Est Name
  CA547286.1 - CA550291.1 - BY145312.1 - BY775830.1 - BY147967.1 - CJ078204.1 - BY111841.1 - BY785168.1 - BY787050.1 - BY119230.1 - AW227798.1 - BY070092.1 - BY134818.1 - CN689273.1 - BY117554.1 - BY793707.1 - BY148270.1 - BY791325.1 - BY330200.1 - AA396689

 
Come back to gene CA547286.1 - CA550291.1 - BY145312.1 - BY775830.1 - BY147967.1 - CJ078204.1 - BY111841.1 - BY785168.1 - BY787050.1 - BY119230.1 - AW227798.1 - BY070092.1 - BY134818.1 - CN689273.1 - BY117554.1 - BY793707.1 - BY148270.1 - BY791325.1 - BY330200.1 - AA396689


For any suggestions or comments, please send an email to unitrap@crg.es