Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10578F6
Clone ID IST10578F6
Vector VICTR76
Project tigm

Sequence tag IST10578F6HMF1
Sequence
CATGAATGTTAGTTGCTGCCCAAGGAGGTCAGAAGAGGGTATCAGATCCCCTGGAATTGGAGTTACAGATGATCTACTAT
GTGGGTGCTCGGAACTGAACCTGGGTCCTCTACAAAAGCAATGAGTACTCTTAGCCACTGAGCTTTCTCTCCAGCTCCAA
CTTTCCACATTCTTCTTGCTACTCANAGCACATGGTAGGAATACAGAGCTTACCTGGGGAGCAGGGACGGCATGTGGTTT
GACATCGTGGGTTATCGGTAACCAGCCATACTGAGTCACGACGTCGNGGGAATTGAAGAGCTGTTTCTTCAGGGTTAAAT
ACNAGTGGAAAGAAACACCCAANTGTTTGTAACACCTTTCACTTGGAAGTTTAGAGATGAACCCTGGTGGACNAGTTTCC
ATGGTAATGTTATAAGTAGAGGCAATCACACATTCACATGCCTGANAAGAAATAATCAGTGTTAGAGCCTTGAGACNAGT
ATTTTNAGTCNAGCTATAANTAANACAATGAATCNTCCGTATGCTANGCAGANTTAAAGTGGGTAAATTAANGNATTTTT
TTTTN
Sequence Type genomic DNA
Unitrap ID UNI16296

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66485887..66486450 532
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019873 (Reep3) NM_178606 receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]


Sequence tag IST10578F6BBF1
Sequence
CATGAATGTTAGTTGCTGCCCAAGGAGGTCAGAAGAGGGTATCAGATCCCCTGGAATTGGAGTTACANATGATCTACTAT
GTGGGTGCTCGGAACTGAACCTGGGTCCTCTACAAAAGCAATGAGTACTCTTAGCCACTGAGCTTTCTCTCCAGCTCCAA
CTTTCCACATTCTTCTTGCTACTCANAGCACATGGTAGGAATACAGAGCTTACCTGGGGAGCAGGGACGGCATGTGGTTT
GACATCGTGGGTTATNNNNNNCCAGCCATACTGANTCACGACGTCGTGGGAATTGAAGAGCTGTTTCTTCANGGTTAAAT
ACAAGTGGAAAGAAACACCCNNNTGTTTGTAACACCTTTCACTTGGAAGTTTANAGATGAACCCTGGTGGACNAGTTTCC
ATGGNAATGTTATNNGTAGANGCAATCACACATTCACATGCCTGANAAGAAATAATCNGTGTTAGAGCCCTTGNNACNAG
TATTTTNAGTCTANCTNTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000019873


For any suggestions or comments, please send an email to unitrap@crg.es