Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15003F3
Clone ID IST15003F3
Vector VICTR78
Project tigm

Sequence tag IST15003F3HMR1
Sequence
TCCTCAGGATCTCTGTCCTGGGCTGGGCCTTTCATATTTCTCTCCTGAAGTACAGCTGCCTTTTGCTTTGCTTTTCTAGC
TGTCCTTCTCTAACCCAGGTCCTACATGCTAACCTTACCCTGATTTCTAAATGAAGGATGCTTCAGTTCAGTAACTTCAT
ACCGTCCTTAAGCATTGGGTCCAGGCTGCTACATTCTGCACATTCCACAGCAACAGCTTCCCATGGACCTGGTAAACAGT
GCCGCTCTCCACTCCTGATCTGGCTCTCANGAGTCTTAATTCCTTTTTTAGTATCATGTGCANCCCTTGAACTCTGGTTC
CCTTACCTCTTACCNCCTTCCTCTTGCCTTTTCTTTTTGACCTTCAACTCTCTCTTTAAAGGACTCTTTTTTANACCTGC
CTTACTCTCTANANNGGNTGGGCNCTTTGGGGGGGGGGGGGA
Sequence Type genomic DNA
Unitrap ID UNI5670

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 108922585..108923025 423
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068184 (Ndufaf2) NP_001120818 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 2 Gene [Source:MGI Symbol;Acc:MGI:1922847]


Sequence tag IST15003F3HMF1
Sequence
AGGACAGAGAATATACTGTGGATTCAAAAGCTATGTAGAAAGGATAGTTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 108923022..108923075 54
NO GENE  


Sequence tag IST15003F3BBF1
Sequence
AGGACAGAGAATATACTGTGGATTCAAAAGCTATGTAGAAAGGATAGTTGGCCNTCCTGGTATTCACAGGGAGTCGAAAA
AAAAAANTGTTAAATCNNATTCNNAANTTTCTGTCTANACATGTANTTGTGGAGTTAAATATGGCTACCATTCNTAANNA
CGGACTGTTTGACTATTCNNCAAAACTTTTGCTTTCTTTTTTGGGANATAAAATTTTCATTTTTANCNCGGTCNNNCTGA
ATCACNNGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000068184


For any suggestions or comments, please send an email to unitrap@crg.es