Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14538A8
Clone ID IST14538A8
Vector VICTR74
Project tigm

Sequence tag IST14538A8HMR1
Sequence
NNNTAGAGCNATAGTCTTATTCTTAGAACCTGGTGATATAGTTACTTTTGAGTTTTATAGAATTGACAGAAACTTAGTAA
TATTAATTGTAACTTGCCCCAGGTTGCCCAATTGACAATTGAACCCAGAGACATTCCTGGGTAAGATGGCTTTTTCCGCT
GTACTTCTCAGTAGTAATATAAATTTCTTTTATGGCCTGGAAGTTTTCAGTTTCACAGAAGTTGTCAGGGAAAATGCAGT
GAACATANATACCNNACTGGTGGTCC
Sequence Type genomic DNA
Unitrap ID UNI14180

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 30839557..30839818 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047412 (CT025653.7-201) NM_172765 Zinc finger and BTB domain-containing protein 44 (BTB/POZ domain-containing protein 15) [Source:UniProtKB/Swiss-Prot;Acc:Q8R0A2]


Sequence tag IST14538A8BBF1
Sequence
NNACAAAGCANAGCATTGTTGCACAAAGTAAGTAAACCTGGTTTTTGTAATTAATAAATACAAATCATCNCNNNNTACAA
ATGGATTAAGAAAACACTCCTTTTTATATTCCATGGGGAGAACTACAAAGACATAAACGAATATTATAAATCAACTGGAA
ATCAAAGTAAATAGGAACAAAAAAATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 30839373..30839556 172
NO GENE  

 
Come back to gene ENSMUSG00000047412


For any suggestions or comments, please send an email to unitrap@crg.es