Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10122A10
Clone ID IST10122A10
Vector VICTR76
Project tigm

Sequence tag IST10122A10HMF1
Sequence
AGGTCTAGCCGAAGGTTTCACCACTGGTGCCGTCTCCTGCCCAATTCCAAAATGGCGCTGACTGGCCTCACTAAGAGTTT
CGAGCTTCCCATGATCCTCACTGGCCTAAAGGTCAGGTGACGCAAGCCTCAGCCGGAAGTTAAGGAATAGGCGCTTCCAG
CCCGCGGCGCTTGCGCANAANGCTCTANACGCTGAGAGGTAGGAGGCACTTGGGATCGTCCGCAGGGTTTGGGACAGCTA
CAGAGGCCGCCACGGAGCCCGCCGGNNCCCCCGTTCCTGCTGGTGCTGCCGCCGCCCGAATCGGAACCGTCGGGCTGCAG
CCGCCGGCAATGCCNNNAANNAAGGTGAGAAATGGCANAGAAGGGATGGCGGGTTTCTAAGGGGAGTCGATTGAGTAACG
TGACGCGGTTGGA
Sequence Type genomic DNA
Unitrap ID UNI2477

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95171281..95171692 390
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038909 (Myst2) NM_177619 MYST histone acetyltransferase 2 Gene [Source:MGI (curated);Acc:Myst2-002]


Sequence tag IST10122A10BBR1
Sequence
ACCTTTTTAGTTAGGTAGGCGGCATTCGTGTGGGATTAGGTAGCCATGATTGTTTGGGGCAGAAGTCTGGCAGTTGAAGG
TAACCGTTTTCATCTTTACATTGGGCAAACTCTTCCTTCCTCGTCGTTTTAATTTGTGGCGTGGAGGGAGGAAAACCCCA
GAATCCATCAGGTTGTCGATCTTTAACTCTTTCATTTCCTAGTCGGCCGAAGGACGTTTCCGTTCATTCTGTAAACTCCG
AACTGGCAAGAGATATTTTGCCCAAGGAACTGCTGTAAGAGCTATTCCGTGTTCCGGAGTGGTGTGAATGGGGCTTGAAT
AAAGGATTGACAGGGTCGTTGTCGGTCTTGAAGTGGGGTAGAGTGTTCTCTTTATGCCTTGTCCTTGCGTTAAGAGAACA
AGAAGTAAGTTATGAGATGATGCAGAGCCATTCTCAGGATGCCGGAGCGCCAAAGAATTTCCAGTTTATCTCTGTTGTGA
AACGCCCCCGGCTTATCAGTGCTCTGCTTTGGTTTGAGATCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95171689..95172209 521
 
EST/CDNA Est Name
  BY334693.1 - CJ172214.1 - CJ173458.1 - BY232008.1 - BY230182.1 - BE647330.1 - BY235332.1 - BB849166.1

 
Come back to gene BY334693.1 - CJ172214.1 - CJ173458.1 - BY232008.1 - BY230182.1 - BE647330.1 - BY235332.1 - BB849166.1


For any suggestions or comments, please send an email to unitrap@crg.es