Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M021B08
Clone ID M021B08
Vector U3betageo
Project ggtc

Sequence tag M021B08
Sequence
AGGCTTTGTCCGGTTCGGCGGTCTTTCTGTGAGGGTGTTTCGACGCGCTGGGCGGTTTGTGCTTTCATCACATTTGTTAA
CAGGTATTTGTCTACGGCGTTTGAATCATGGGAGGATTTAGAGAGGGGGCTTACGTGTT
Sequence Type mRNA
Unitrap ID UNI10969

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62365015..62365151 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019505 (Ubb) NM_011664 ubiquitin B Gene [Source:MGI (curated);Acc:Ubb-001]

 
Come back to gene ENSMUSG00000019505


For any suggestions or comments, please send an email to unitrap@crg.es