Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W163B02
Clone ID W163B02
Vector ROSAbetageo
Project ggtc

Sequence tag W163B02
Sequence
CGGGACCAGAGGCAGTGTGTGAGAACCGTGGCCGCTGGAGGGGTCGGGGGGAGAAGCNNNGGAGCCGCTCGCGAAGGCCA
AGTCATGACTACAGTAGTGGTACATGTGGACTCCNNNGCTGAGCTCACTACCCTGCTGGAGCAGTGGGAAAAGGACCATG
GCAGTGGCCAGGATATGGTACCAATCCTTACCAGAATGTCTGAATTAATTGAAAAAGAAACTGAAGAATATCGTAAAGGA
GATCCAGATCCATTTGATGATCGACATCCT
Sequence Type mRNA
Unitrap ID UNI9286

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106724347..106733264 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040325 (Vprbp) NM_001015507 Vpr (HIV-1) binding protein Gene [Source:MGI Symbol;Acc:MGI:2445220]

 
Come back to gene ENSMUSG00000040325


For any suggestions or comments, please send an email to unitrap@crg.es