Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12580C11
Clone ID IST12580C11
Vector VICTR76
Project tigm

Sequence tag IST12580C11HMF1
Sequence
CTAGAATTCCGGATGGAGGAGAGTTCAGTGTGAGTTCCTACTCCAGGCGTCCCTTTTTCACCCTGGCTTCAACCGTCTCG
GCCTCAGGGCCGGCCGCGAAGCCTTAGTGAGGAGGTGAGGCCAGGGGGTGCGGGTAGCGGCGGTGTCGGTGTCGGTGTCG
GTGACTGAAGTGGGGGGAGGGAGCGAAAATGGAAACTCCGACCGCAGCCAAGATGGAGGCAGAGGGTGCGGGGCTCGGGC
GCGAAGGCTGCCGGGAGCTGTAGTCCGTCCTCTTCCCCCTCTGCGGCTTGGCGGGGGAAAGGGAACTACNANTCCCGGCG
GGAGGGGTGAGGGGGTGGTGNNNCNNTCCTTTGTGTGCNNCTGGAANNNGCCNGN
Sequence Type genomic DNA
Unitrap ID UNI7671

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102824701..102825066 348
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068823 (Csde1) NM_144901 cold shock domain containing E1, RNA binding Gene [Source:MGI Symbol;Acc:MGI:92356]

 
Come back to gene ENSMUSG00000068823


For any suggestions or comments, please send an email to unitrap@crg.es