Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14841D11
Clone ID IST14841D11
Vector VICTR76
Project tigm

Sequence tag IST14841D11HMF1
Sequence
AAACTTTTAATCTTAAAACAAAATACCTCCCAAATCAAATGATAATGCACATCAGCACCCAAGCTGCCCTCCACGCACGC
ACAATTCCGCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4791455..4791547 93
NO GENE  


Sequence tag IST14841D11HMR1
Sequence
TTTTCTTGTCNAGAGCGGCATTTAAAAGACTGTTGAAGCTGGGTGATGGTGGCAAATGCCTTTAAATAGTCCCAGCACTT
GAGAGTCAGAGGCAGGTGGAA
Sequence Type genomic DNA
Unitrap ID UNI100

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4791358..4791457 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056951 (Rbm4) NM_009032 RNA binding motif protein 4 Gene [Source:MGI Symbol;Acc:MGI:1100865]

 
Come back to gene ENSMUSG00000056951


For any suggestions or comments, please send an email to unitrap@crg.es