Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12496H9
Clone ID IST12496H9
Vector VICTR76
Project tigm

Sequence tag IST12496H9BBF1
Sequence
CTTTCACGGAACGCCGTCGTTTCTCGGCTCAGGCCCCGCTACGGCCCCGCCTGGGCCTGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI17198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91648297..91648360 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022961 (Son) NM_019973 Son DNA binding protein Gene [Source:MGI (curated);Acc:Son-001]


Sequence tag IST12496H9HMF1
Sequence
ATATAAGGCTGACATTTTAAGGGGAAGGGATATTTTTCTTTTATGAATATATTTTATTTTATGTATATGAGTGTTTTAAC
AGCATATAAATCTGTGTACCACATTTGTCTGGTGTCCAAGAAGGTGAGAAGCGGGGATCAATCCCCTGGAACTGGAATTA
CAGACAGTTGTGTGTGTTGGGAACTGAATTCANATCCTCTGCANCAGCAGCCAGGGAGGCTCTTAAATCACTAAGCCATC
TNNCTAGCTTCTANNANGGTGTTTTTGNNCANATTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 21142500..21142775 256
 
EST/CDNA Est Name
  AA990349.1 - AA028210.1 - AA021806.1

 
Come back to gene AA990349.1 - AA028210.1 - AA021806.1


For any suggestions or comments, please send an email to unitrap@crg.es