Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W162C04
Clone ID W162C04
Vector ROSAbetageo
Project ggtc

Sequence tag W162C04
Sequence
GTATGGTTCATGGCTGCTGCAGAAAATGTCATTAGTTGTTAAGCTTAATATTTTCTGTGAGAAGGGGCTTTCTTTTCTAA
ATAATCTGTTTTGGTGTTTTTCTTTCCCCTCTTCTGGATTGCAGAGGGTAACGTNNNGAGAAGCTCTGTAGTGTGGTAGT
ATCATAGAGTAGATTGGCCCACCTCTTCTGCTCGTAGACTAGCACACTCCAACATAAGGCCACATTGATCCAGCGATCCT
AGTGGCTGCTTTTAAGGCCTGATTGTTGTAGAAATTTTCTTGTTAGTTGACACAGTCCCCTCGAGGCCCCAAAAGAGAGG
GCGGAGGCCGTGGCCCGGCTGGCCAAGGAGGTCATGGAGGGGGTGTATCCCCTGGCCGTGCCC
Sequence Type mRNA
Unitrap ID UNI12521

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 25312716..26191403 294
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025290 (Rps24) NM_011297 ribosomal protein S24 Gene [Source:MGI Symbol;Acc:MGI:98147]

 
Come back to gene ENSMUSG00000025290


For any suggestions or comments, please send an email to unitrap@crg.es