Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14193B9
Clone ID IST14193B9
Vector VICTR74
Project tigm

Sequence tag IST14193B9BBF1
Sequence
TTACTAGTAGTTAAGTGGACTCTGTTTTGAGCAAACCCGCTGACTATGACCACCCAGTGACTAACCCATTTCGCTTCAGA
ACAAACCCATTGTGTCTTACAGCCGTTAGGAGGCTGGGACAGCATGCAAATCTGACACAGACCGCGAGACTGCCCCCTAA
GAACCTGTCGGTTCCTCCTGCCCCCTGTCCCCGCCTTCACCCCAACCCTACTAGCAACTTGGTAACTGACTGGGAAGAAA
AGCCTCCTGTCTTGGGGCCCCAAGCCGGAAGCCTCCCCAACCCGGTCCCGGGCAGGGGAAGGGGCGGGCACAGGCAGCAG
CAGCTCANAAGATGCACGCGGGGCTCCTGGGGCTCTCTGCCCTGCTGCAGGCGGCCGANCANAGCNCNCGTGANTGANGC
NCANCCCNNNAGTGCNNAN
Sequence Type genomic DNA
Unitrap ID UNI33247

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 18950850..18951262 389
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039814 (Xkr5) NM_176951 X Kell blood group precursor-related family, member 5 Gene [Source:MGI (curated);Acc:Xkr5-001]


Sequence tag IST14193B9HMR1
Sequence
GTNNGANTGGTGTATGTGTGTATGTGTATNATGGGAGGANGAATTTGAAAAGCTGATTGGGACTTTTGAANAATTTCAGT
TGTGTGTCCNNANAAGGGAAAGGAAACACNCCTAAAATGGCATCTGANCCTTTAATAGCCGCTTTGCTTTCNGACCTTTC
TNCCAGGTATCCTTGAGGGGTTAATCCAGANCCCCCAAAGCCNGAAGTAAACCTTCNCACGGANAGTCTTTCTGGGANAT
GGNAANNCATCNCNCTGACATTTGTTTCGATGTANAGGTTACNCNGGNCTGTGGACNTGNNNNCNAAGANTGNTCNGAAT
CGTCCATGCNCANCGNANAAATGNTTNANAACCCTTGANCNNGCNTGGCANGANATTNCTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039814


For any suggestions or comments, please send an email to unitrap@crg.es