Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W080B06
Clone ID W080B06
Vector pT1betageo
Project ggtc

Sequence tag W080B06
Sequence
AAAAGAAAGAAATTAAAGTGGAAGTAGAAGTAGAGGTGAAAGAAGAAGAGAATGAAATTAGGGAAGATGAGGAGCCTCCC
AGGAAGAGAGGGAGAAGGCGAAAAGATGACAAAAGTCCGCGGTTACCCAAAAGGAGAAAAAAAGCCTCCAATCCAATATG
TCCGTTGTGAGATGGAAGGATGTGGAACTGTTCTTGCTCACCCTCGCTATTTGCAG
Sequence Type mRNA
Unitrap ID UNI12522

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 12850485..12851434 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024695 (Zfp91) NM_053009 zinc finger protein 91 Gene [Source:MGI (curated);Acc:Zfp91-001]

 
Come back to gene ENSMUSG00000024695


For any suggestions or comments, please send an email to unitrap@crg.es